DOKUMEN123.COM

Look up candida in Wiktionary, the free dictionary. Candida, or Cándida (Spanish), may refer to: Candida (fungus), a genus of yeasts Any of several yeasts...

Candida albicans is an opportunistic pathogenic yeast that is a common member of the human gut flora. It can also survive outside the human body. It is...

Candida is a genus of yeasts. It is the most common cause of fungal infections worldwide and the largest genus of medically important yeasts. The genus...

due to any species of yeasts in the genus Candida or those that were formerly classified in genus Candida but are now classified in the genus Candidozyma...

Candida, Cândida or Cándida is a feminine given name from Latin candidus (white). Notable people with the name include: Saint Candida (disambiguation)...

Candida auris (Candidozyma auris) is a species of fungus that grows as a yeast. It is one of the few species of the genus Candida (Candidozyma) which...

Candida Royalle (born Candice Marion Vadala; October 15, 1950 – September 7, 2015) was an American producer and director of couples-oriented pornography...

Candida tropicalis is a species of yeast in the genus Candida. It is a common pathogen in neutropenic hosts, in whom it may spread through the bloodstream...

S. candida may refer to: Salix candida, the sageleaf willow, a shrub species found in northern United States and Canada Sidalcea candida, the white checkermallow...

M. candida may refer to: Mammillaria candida, the snowball cactus, a plant species found in Mexico Miltonia candida, the snow-white miltonia, an orchid...

Look up Candida in Wiktionary, the free dictionary. Saint Candida most commonly refers to Candida the Elder (died c. AD 78), early Christian saint from...

C. candida may refer to: Cancellaria candida, a sea snail species Cyclaspis candida, a crustacean species in the genus Cyclaspis Carneades candida, a...

‹ The template Infobox play is being considered for merging. › Candida (Shavian: 𐑒𐑩𐑯𐑛𐑦𐑛𐑳), a comedy by playwright George Bernard Shaw, was written...

shock cases; the most common cause of fungal sepsis is an infection by Candida species of yeast, a frequent hospital-acquired infection. The most common...

candidiasis is a mycosis (yeast/fungal infection) of Candida species on the mucous membranes of the mouth. Candida albicans is the most commonly implicated organism...

"Candida" is the debut single by American pop music group Dawn, with vocals by Tony Orlando, released in July 1970. The song, written by Irwin Levine...

di Candida (d. 1283), 1st Lord of Candida. Riccardo Filangieri di Candida (d. 1321), son of the previous, became 2nd Lord of Candida. Pietro Candida (b...

Zephyranthes candida, with common names that include autumn zephyrlily, white windflower, white rain lily, and Peruvian swamp lily, is a species of rain...

A. candida may refer to: An abbreviation of a species name. In binomial nomenclature the name of a species is always the name of the genus to which the...

Candida. These yeast are normally present in the vagina in small numbers. Vaginal yeast infections are typically caused by the yeast species Candida albicans...

G. candida may refer to: Gardenia candida, a plant species endemic to Fiji Gibberula candida, a very small sea snail species Glyphostoma candida, a sea...

N. candida may refer to: Nesta candida, a sea snail species Nymphaea candida, an aquatic perennial herbaceous plant species native to quiet freshwater...

Mammillaria candida, the snowball cactus, is a species of cactus endemic to Mexico. When treated as Mammilloydia candida, it was the only species in the...

The blue-billed white tern (Gygis candida) is a small tropical seabird in the family Laridae, occurring across the Indian Ocean and Pacific Ocean. Formerly...

Brugmansia × candida (syn. Datura × candida), the angel's trumpet, is a hybrid species of flowering plant in the family Solanaceae. Its parents are Brugmansia...

R. candida may refer to: Rodriguezia candida, an orchid species found from northern South America to Brazil Ramularia candida, a synonym for Nectria ramulariae...

L. candida may refer to: Laelia candida, a synonym for Laelia albida, an epiphytic orchid species found in Mexico Leptothyra candida, a sea snail species...

Candida parapsilosis is a fungal species of yeast that has become a significant cause of sepsis and of wound and tissue infections in immunocompromised...

Candida Höfer (born 4 February 1944) is a German photographer known for her exploration of public spaces and architecture. In her career she transitioned...

Candida dubliniensis is a fungal opportunistic pathogen originally isolated from AIDS patients. It is also occasionally isolated from immunocompetent...

Pichia kudriavzevii (formerly Candida krusei) is a budding yeast (a species of fungus) involved in chocolate production. P. kudriavzevii is an emerging...

Barbatia candida, or the White-bearded ark clam, is a clam in the family Arcidae. It can be found along the Atlantic coast of North America, ranging from...

Trimezia candida, synonym Neomarica candida, also known as white walking iris, is species of flowering plant. It was first described by Emil Hassler and...

Candida the Elder (Italian: Candida la Vecchia) (died c. AD 78) was a legendary early Christian saint and resident of Naples, Italy, who is venerated...

Candida R. Moss FRHistS (born 26 November 1978) is a British journalist, New Testament scholar and historian of Christianity, and as of 2017, the Edward...

Z. candida may refer to: Zephyranthes candida, the white fairy lily or white rain lily, a plant species native to the Rio de la Plata region of South America...

theater, appearing three times on Broadway, in Romeo and Juliet (1951), Candida (1952), and A Gift of Time (1962). She also worked in television, appearing...

Candida Casa was the name given to the church established by St Ninian in Whithorn, Galloway, southern Scotland, in the mid fifth century AD. The name...

Melissa Cándida Doi (September 1, 1969 – September 11, 2001) was an American senior manager at IQ Financial Systems, who died in the September 11 attacks...

Candida Baker (born 1955) is an Australian author, photographer, journalist and natural horsemanship practitioner. She was born in England and moved to...

from the Greek blastós ('sprout', 'bud', or 'germ') and sporá ('spore'). Candida albicans, a well-known example of a fungus that forms blastospores, is...

Folsomia candida is a species of springtail in the family Isotomidae. It is found in soil in many locations around the world, having been spread inadvertently...

3.4.23.24, Candida albicans aspartic proteinase, Candida albicans carboxyl proteinase, Candida albicans secretory acid proteinase, Candida olea acid proteinase...

infection (candidiasis) that can be caused by various species of Candida yeast. Unlike Candida infections of the mouth and throat (oral candidiasis) or vagina...

Albugo candida, commonly known as white rust or white blister rust, is an obligate plant pathogen in the family Albuginaceae that infects Brassicaceae...

Diaperia candida, common names silver pygmycudweed and silver rabbit-tobacco, is a plant species in the sunflower family, native to the south-central...

Candida Mary Doyle (born 25 August 1963) is a musician from Northern Ireland. She is the keyboardist for the band Pulp, which she joined in 1984. She...

Candida Alvarez (born 1955) is an American artist and professor, known for her paintings and drawings. Alvarez has exhibited at the Whitney Museum of...

Dalea candida is a species of flowering plant in the legume family known by the common name white prairie clover. It is native to North America, where...

these infections are sexually transmitted, however a yeast infection, Candida balanitis, is generally not categorized as such. It is less common among...

Candida blankii is a species of budding yeast (Saccharomycotina) in the family Saccharomycetaceae. The yeast may be a dangerous pathogen and resistant...

Candidal intertrigo is an infection of the skin by Candida albicans, more specifically located between intertriginous folds of adjacent skin. Candidiasis...

arabinofermentans Candida argentea Candida ascalaphidarum Candida aurita Candida bentonensis Candida berolinensis Candida bertae Candida blackwelliae Candida blancii...

Nymphaea candida is a species of perennial, aquatic, rhizomatous herb in the family Nymphaeaceae native to the region spanning from Europe to Siberia...

Renato Candida (30 September 1916 – 11 October 1988) was an Italian carabiniere. While stationed in Agrigento in Sicily, he wrote Questa mafia ("This...

species of haploid yeast of the genus Nakaseomyces, previously known as Candida glabrata. Despite the fact that no sexual life cycle has been documented...

Salix candida, also known as sageleaf willow, is a shrub in the Salicaceae family found in northern United States and Canada. It is 0.5 to 3.5 m tall...

performance in The Invention of Love in 2001. His other theater credits include Candida, Long Day's Journey Into Night, Breaking the Code, The Speed of Darkness...

Candida Xu or Candida Su (Chinese: 許徐甘弟大; pinyin: Xǔ-Xú Gāndìdà; Wade–Giles: Hsü3-Hsü2 Kan1-ti4-ta4; French: Candida Hiù; September 4, 1607 – July 24,...

Candida viswanathii is a species of yeast in the genus Candida. It is named after the noted Indian pulmonologist, Raman Viswanathan. A strain found in...

(Telma Hopkins and Joyce Vincent Wilson). Their signature hits include "Candida", "Knock Three Times", "Tie a Yellow Ribbon Round the Ole Oak Tree", "Say...

Fautrix candida is a species of sea snail, a marine gastropod mollusc in the family Calliostomatidae. Fautrix candida was identified by Dr. Bruce Marshall...

Arval brothers. Toga candida: "Bright toga"; a toga rubbed with chalk to a dazzling white, worn by candidates (from Latin candida, "pure white") for public...

Cândida Branca Flor (12 November 1949 – 11 July 2001) was a Portuguese entertainer and traditional singer whose career spanned four decades. Cândida Branca...

Candida is a 1970 album by Dawn, a studio session group including Tony Orlando, Toni Wine, and Linda November. Orlando was singing under the group name...

Saperda candida var. bipunctata. Saperda candida is preyed upon by the parasitoid wasp species Cenocoelius saperdae. BioLib.cz - Saperda candida. Retrieved...

P. candida may refer to: Palicourea candida, a plant species endemic to Ecuador Partula candida, an extinct gastropod species endemic to French Polynesia...

resting spore of several kinds of fungi, including Ascomycota such as Candida, Basidiomycota such as Panus, and various Mortierellales species. It is...

lusitaniae, formerly also known by the anamorph name Candida lusitaniae, is a species of yeast in the genus Candida or Clavispora. The species name is a teleomorph...

in April 2010. While appearing as Marchbanks in George Bernard Shaw's Candida at the Irish Repertory Theatre, New York, in April 2010, Underwood was...

Candida oleophila is a species of yeast in the genus Candida in the family of Saccharomycetaceae. It is used in post-harvesting fruit and vegetables as...

Candida is a 1961 TV play starring Wendy Craig, Patrick, Peter McEnery, Peter Sallis, Rosamund Greenwood, Michael Brennan. The movie is based on George...

sex-positive feminists like Susie Bright, performers Nina Hartley, and Candida Royalle affirmed the rights of women to consume and produce porn. The works...

infection, irritation, or allergies. Infections include by fungi such as Candida albicans and bacteria such as Staph. aureus. Irritants include poorly fitting...

Candida hypersensitivity is a pseudoscientific syndrome promoted by William G. Crook, M.D. It is spuriously claimed that chronic yeast infections are...

Candida Rose Lycett Green (née Betjeman; 22 September 1942 – 19 August 2014) was a British author who wrote sixteen books including English Cottages,...

genus Meyerozyma whose asexual or anamorphic form is known as Candida guilliermondii. Candida guilliermondii has been isolated from numerous human infections...

The blue-billed white tern (Gygis candida) is a small seabird found in Pacific and Indian oceans. This species was previously considered as conspecific...

Sidalcea candida, commonly called the white checkerbloom, prairie mallow or white checkermallow, is a wildflower found from Nevada to Wyoming and south...

Emília Cândida (1823–1908) was a popular 19th century Portuguese actress. Emília Cândida Madeira was born in the Portuguese capital of Lisbon on 18 May...

Lophyra candida is a species of tiger beetle found in South Africa. Catalogue of Life: Lophyra (Lophyra) candida v t e...

obtained from Streptomyces griseus. It is active against some fungi including Candida albicans. Candicidin is administered intravaginally in the treatment of...

Candida theae is a species of yeast in the genus Candida. The species name means "tea". It was first isolated from Indonesian tea drinks and in Quito from...

Xanthosia candida is a low-lying, perennial herb in the family Apiaceae and is endemic to the south-west of Western Australia. It has long, slender stems...

ultimately human biology in great detail. Other species of yeasts, such as Candida albicans, are opportunistic pathogens and can cause infections in humans...

women: Candidiasis: vaginitis caused by proliferation of Candida albicans, Candida tropicalis, Candida krusei Bacterial vaginosis: vaginitis caused by increased...

Gardenia candida is a species of asterid flowering plant in the family Rubiaceae. This species is endemic to Fiji, where it is known from the Seanggangga...

treatment of non-systemic Candida infections of the vagina ("yeast infections"), throat, and mouth. Certain systemic Candida infections in people with...

and Candida Royalle. John C. Holmes as John Bob Chinn as Bob (as Danny Hussong) John Seeman as Inspector Blackie Desireé Cousteau as Ann Chovy Candida Royalle...

is grown on vineyard land located at high elevations. Malvasia Candida Malvasia Candida (different from the variety known as Malvasia di Candia) has been...

Candida is a small town and comune (municipality) in the province of Avellino within the Campania region of Italy. It sits on top of a hill, at an elevation...

the nail plate by fungus caused by Candida. In one study Candida parapsilosis was the most common species; Candida albicans is also a common agent. Onychomycosis...

Lymire candida is a moth of the subfamily Arctiinae. It was described by William Trowbridge Merrifield Forbes in 1917. It is found on Jamaica and Hispaniola...

Maudiozyma humilis (prev. Candida humilis and Kazachstania humilis) is a species of yeast in the genus Maudiozyma. It commonly occurs in sourdough and...

Jarvis Cocker (vocals, guitar, keyboards), Russell Senior (guitar, violin), Candida Doyle (keyboards), Nick Banks (drums, percussion), Steve Mackey (bass)...

Cleopatra Was Candida (Spanish:Cleopatra era Cándida) is a 1964 Argentine comedy film directed by Julio Saraceni and starring Niní Marshall, Juan Verdaguer...

Cándida Montilla de Medina (née Montilla; born 3 October 1962) is a Dominican clinical psychologist. The wife of former president, Danilo Medina. Montilla...

Exidia candida is a species of fungus in the family Auriculariaceae. Basidiocarps (fruit bodies) are gelatinous, whitish, and cushioned-shaped at first...

Quercus alba f. sublyrata Trel. Quercus alba f. viridis Trel. Quercus candida Steud. Quercus nigrescens Raf. Quercus ramosa Dippel Quercus repanda Michx...

Torodora candida is a moth in the family Lecithoceridae. It was described by Kyu-Tek Park in 2008. It is found in Palawan in the Philippines. "Torodora...

Candida is a 2006 Spanish comedy film by Javier Fesser with Candida Villar, Jorge Bosch and Raul Pena. The film was nominated in the category Best Original...

Dudleya candida is a species of perennial succulent plant in the family Crassulaceae known by the common names Coronados liveforever or chalk rose. It...

Candida Brush is the Franklin W. Olin Professor of Entrepreneurship at Babson College. She is one of the founders of the Diana Project at Babson. As a...

Carlo Candida (Lucera, 7 October 1762 – Rome, January 1845) was a lieutenant of the Sovereign Order of Malta from 1834 to his death, succeeding Antonio...

Corymbia candida, commonly known as desert ghost gum or ghost gum, is a bloodwood native to arid parts of the Northern Territory and Western Australia...

Ditrigona candida is a moth in the family Drepanidae. It was described by Wilkinson in 1968. It is found in the Yunnan province of Southwest China. Beccaloni...

Brooklyn Candida Rodriguez (born c. 2002), known professionally as Bktherula, is an American rapper and singer from Atlanta, Georgia. Born in 2002, Brooklyn...

Canbya candida (common names: pygmy poppy, white pygmy poppy) is a tiny, white flowered annual plant in the genus Canbya of the poppy family. It is found...

to the family Liparidae, the snailfishes. Its only species is Temnocora candida, the bigeye snailfish, which is found in the far northern Pacific Ocean...

dioceses. The diocese of Santa Rufina was also formerly known as Silva Candida. From 1967, the diocese has had both a titular cardinal bishop, and a resident...

Tephrosia candida, the white hoarypea, is a perennial shrub, native to India, in the legume family. It has been introduced to Malesia, South America,...

The white-bellied emerald (Chlorestes candida) is a species of hummingbird in the "emeralds", tribe Trochilini of subfamily Trochilinae. It is found in...

Dirina candida is a species of saxicolous (rock-dwelling), crustose lichen in the family Roccellaceae. It is found in the southern Mediterranean basin...

The Massa Candida were 153 or 300 early Christian martyrs from Utica who were martyred for their refusal to offering incense to Roman idols, around AD...

Candida, Millionairess (Spanish: Cándida millonaria) is a 1941 Argentine musical comedy film of the Golden Age of Argentine cinema, directed by Luis Bayón...

as Torulopsis haemuli in 1962. In 1978, the fungus became classified as Candida haemulonii. Oval cells are present at a microscopic level. The fungus has...

Metschnikowiaceae. The genus includes Candidozyma auris (widely known as Candida auris in medical and public health literature) and a set of close relatives...

cheilitis. Candida in its pathogenic hyphal form is occasionally seen in biopsies of idiopathic leukoplakia. It is debated whether candida infection is...

1 June, also celebrated as Dorset Day. She is also known as Saint Candida (Candida is the Latin word for white). Saint Wite is variously spelt as Wite...

Gibberula candida is a species of very small sea snail, a marine gastropod mollusc or micromollusc in the family Cystiscidae. Cossignani (2008). Malacologia...

Weldenia candida is a species of flowering plant which grows natively in Mexico and Guatemala. This herbaceous perennial has broad green, strap-shaped...

Nectopsyche candida is a species of long-horned caddisfly in the family Leptoceridae. It is found in North America. "Nectopsyche candida Report". Integrated...

Cranichis candida is a species of orchid in the subfamily Orchidoideae. It was described by Célestin Alfred Cogniaux. "Cranichis candida (Barbosa) Cogn...

Urceolina candida is a species of flowering plant in the family Amaryllidaceae. It is native to Colombia, Ecuador and Peru but cultivated as an ornamental...

Cryptococcus neoformans, Candida auris, Aspergillus fumigatus, Candida albicans. High priority Nakaseomyces glabrata (Candida glabrata), Histoplasma spp...

Debaryomyces hansenii, also known as Candida famata, is a species of yeast in the family Saccharomycetaceae. Debaryomyces hansenii accounts for up to...

food bait for insects. It is also commonly known as the anamorphic name Candida utilis, which has been discarded under the "one fungus, one name" change...

measured and ringed. The celebration of the island's patron saint, Saint Candida, takes place on 20 September, but the festivities start ten days beforehand...

uncertainty as to whether the cause is Trichomonas vaginalis or Candida strains such as Candida albicans. Side effects appear to be minimal or non-existent...

The bZIP intron candida is an unconventional bZIP intron located in the HAC1 mRNA in a subgroup of fungi from Saccharomycetales order. So far all species...

In Toga Candida was a speech given by the Roman orator Marcus Tullius Cicero in 64 BC, shortly before the election of the consuls for 63 BC. Cicero was...

Cándida Estefany Arias Pérez (born March 11, 1992, in Yaguate, San Cristóbal) is a volleyball player from the Dominican Republic, who won the bronze medal...

claim that cancer is caused by the fungus Candida albicans, and has argued that cancer is a form of candida overgrowth. He also is known for claims that...

stage (teleomorph) of Atelosaccharomyces pseudotropicalis also known as Candida kefyr. This species has a homothallic mating system and is often isolated...

Candida Thompson is a British violinist. Thompson was born in Glasgow, Scotland. She has been living in Amsterdam since 1992. She studied with David Takeno...

Daisy Candida McAndrew (née Sampson; born 20 May 1972) is an English journalist. McAndrew was educated at Wycombe Abbey School, an independent school...

Acrocercops candida is a moth of the family Gracillariidae. It is known from Queensland, Australia. Australian Faunal Directory Global Taxonomic Database...

strain is 10-372T (=CBS 9494T =NCAIM Y016667T). Sipiczki, M. (2003). "Candida zemplinina sp. nov., an osmotolerant and psychrotolerant yeast that ferments...

Maria Candida of the Eucharist, OCD (born Maria Barba; 16 January 1884 – 12 June 1949) was an Italian Discalced Carmelite. Barba desired to become a nun...

doi:10.1099/00207713-46-1-81. PMID 8573524. NOTE: Candida mycoderma, Candida valida, and/or Candida vini are sometimes listed as a starter culture for...

Caenis candida is a species of mayfly in the genus Caenis. It is endemic to Quebec, Canada. ITIS Report October 22, 2016. Retrieved October 22, 2016....

Beadwulf was the last Bishop of Candida Casa to be consecrated by the Northumbrian Archbishop of York. He appears in four years of the chronicles and...

Penicillium camemberti is a species of fungus in the genus Penicillium. It is used in the production of soft-ripened cheeses, including Camembert, Brie...

Esophageal candidiasis is an opportunistic infection of the esophagus by Candida albicans. The disease usually occurs in patients in immunocompromised states...

in full boom, South Africa Bauhinia variegata var. candida in bloom Bauhinia variegata var. candida buds and white flowers "Bauhinia variegata". International...

live shows as a headliner, mostly in Las Vegas, Nevada. When his song "Candida" became an international number-one song, he began to use his name in the...

plants. Examples of ascomycetes that can cause infections in humans include Candida albicans, Aspergillus niger and several tens of species that cause skin...

Year Title Role Notes 1992 Candida Candida Roundabout Theatre Company, Broadway...

"bud" comes from the Greek word blastos, which means bud. Yeasts such as Candida albicans and Cryptococcus neoformans produce these budded cells known as...

Diodora candida is a species of sea snail, a marine gastropod mollusk in the family Fissurellidae, the keyhole limpets. The size of the shell reaches...

Oreodera candida is a species of long-horned beetle in the family Cerambycidae. It is found in Brazil. "Oreodera candida". GBIF. Retrieved 2024-08-15...

Cándida is a 1939 Argentine musical film drama directed by Luis Bayon Herrera during the Golden Age of Argentine cinema. The tango film premiered in Buenos...

Alberada candida is a species of snout moth in the genus Alberada that was described by Herbert H. Neunzig in 1997 and is known from the US state of California...

Euglandina candida is a species of predatory air-breathing land snail, a terrestrial pulmonate gastropod mollusk in the family Spiraxidae. Euglandina candida conularis...

reassignment of Candida catenulata, Candida mesorugosa, Candida neorugosa, Candida pseudorugosa, Candida ranongensis, Candida rugosa and Candida scorzettiae...

Candida Tobin Hon FTCL, LTCL [clarification needed] (5 January 1926 – 14 December 2008) was the author of the Tobin Method, a music education system for...

Miltonia candida, the snow-white miltonia, is a species of orchid endemic to southeastern Brazil. Wikimedia Commons has media related to Miltonia candida. "Miltonia...

Remember Mama (1944) and won Theater World Awards for his performances in Candida and Truckline Cafe (1946). He returned to Broadway as Stanley Kowalski...

Emarginula candida is a species of sea snail, a marine gastropod mollusk in the family Fissurellidae, the keyhole limpets and slit limpets. The size of...

Chart. "Knock Three Times" has roots in the Tokens. The first Dawn song "Candida" was produced by Tokens member Hank Medress and his business partner Dave...

Candida Gertler (born 1966/1967) OBE is a British/German art collector, philanthropist, and former journalist. She was born in Frankfurt am Main, Germany...

Retrieved 6 June 2019. "Brugmansia × candida 'Grand Marnier'". RHS. Retrieved 12 April 2020. "Brugmansia × candida 'Knightii'". RHS. Retrieved 12 April...

created and written by Eylem Canpolat and Sema Ergenekon. Adapted by Cândida Ribeiro and Rita Roberto, it has the collaboration of Ana Casaca, Filipa...

2019 British psychological horror film written, directed and produced by Candida Brady and starring Rupert Everett, Alison Doody, Derek Jacobi and Géza...

Scopula candida is a moth of the family Geometridae. It was described by Prout in 1934. It is endemic to Costa Rica. Sihvonen, Pasi (April 1, 2005). "Phylogeny...

Humbert of Silva Candida, O.S.B., also known as Humbert of Moyenmoutier (c. 1000 to 1015 – 5 May 1061) was a French Benedictine abbot and later cardinal...

brevicalycina (Nakai) Nakai Diervilla florida var. candida (Voss) Rehder Diervilla florida f. candida Voss Diervilla florida var. pilosa Nakai Diervilla...

Candida, Woman of the Year (Spanish: Cándida, la mujer del año) is a 1943 Argentine comedy film of the classical era directed by Enrique Santos Discépolo...

Efferia candida is a species of robber flies in the family Asilidae. "Efferia candida Report". Integrated Taxonomic Information System. Retrieved 2018-04-08...

Transnationalism and Cultural Hybridity in the Americas, ed. Frances R. Aparicio and Cándida F. Jáquez, 81–98. "Puerto Rican Music TV". Puerto Rican Music TV. Archived...

Rodriguezia candida is a species of orchid native to Venezuela, Brazil, French Guiana, Suriname. Wikimedia Commons has media related to Rodriguezia candida. Wikispecies...

that can grow on methanol. The range of methylotrophic yeasts includes Candida boidinii, Pichia methanolica, Pichia pastoris and Ogataea polymorpha. O...

The mock-orange miner bee (Andrena candida) is a species of miner bee in the family Andrenidae. It is found in Central America and North America. "Standardized...

Barnea candida is a marine bivalve mollusc in the family Pholadidae. Right valve Left valve Length: up to 50 mm Width: up to 20 mm. Chalk-white, yellow-white...

non-existence of Jesus as effectively refuted. Writing on The Daily Beast, Candida Moss and Joel Baden state that, "there is nigh universal consensus among...

Leptothyra candida is a species of sea snail, a marine gastropod mollusk in the family Colloniidae. This marine species occurs off Hawaii and the Seychelles...

Delias candida is a butterfly in the family Pieridae. It was described by Samuel Constantinus Snellen van Vollenhoven in 1865. It is found in the Australasian...

mutual excommunications of Leo IX's legate, cardinal Humbert of Silva Candida, and Patriarch Michael I Cerularius of Constantinople started the East–West...

Sternbergia candida is a bulbous flowering plant in the family Amaryllidaceae, subfamily Amaryllidoideae, which is used as an ornamental. This rare bulbous...

Maria Cândida Pereira Teixeira is an Angolan politician. She is the current Minister of Education of Angola, as well as a member of parliament. She is...

Cândida Ivete Vargas Martins (17 July 1927 – 3 January 1984), commonly known as Ivete Vargas, was a Brazilian journalist and politician. Ivete Vargas...

Chasmina candida is a moth of the family Noctuidae described by Francis Walker in 1865. It is found from Indo-Australian tropics east to Fiji, including...

Cycas candida is a species of cycad. It is an endangered species found only in Queensland. Bösenberg, J.D. (2023) [errata version of 2022 assessment]...

Guardian. ISSN 0261-3077. Retrieved March 27, 2019. "Patrick Cowley / Candida Royalle: Candida Cosmica". Pitchfork. Retrieved March 27, 2019. Daniel Heinzmann...

Dendrobium candidum Wall. ex Lindl Dendrobium spathaceum Lindl. Callista candida (Wall. ex Lindl.) Kuntze Callista spathacea (Lindl.) Kuntze Dendrobium...

the original on 26 August 2018. Retrieved 18 November 2023. Morvillo, Candida (23 October 2023). "Piero Piazzi: 'Da Carla Bruni a Naomi, sono stato il...

and the human pathogens Candida albicans and Candida tropicalis. A study of the evolution of sexual reproduction in six Candida species concluded that...

Los Celos de Cándida is a 1940 Argentine comedy film of the Golden Age of Argentine cinema, directed by Luis Bayón Herrera and starring Niní Marshall...

with phenolic acids. Moesziomyces antarcticus contains a lipase enzyme (Candida antarctica) that is able to cleave ester bonds in PET plastic. Sugiyama...

has media related to Stanhopea candida. Wikispecies has information related to Stanhopea candida. "Stanhopea candida Barb.Rodr". Plants of the World...

animals, including Coccidioides immitis, Paracoccidioides brasiliensis, Candida albicans, Blastomyces dermatitidis, Histoplasma capsulatum, Sporothrix...

known as candidemia, candedemia, or systemic candidiasis, is caused by Candida species. Candidemia is also among the most common bloodstream infections...

Volvarina candida is a species of sea snail, a marine gastropod mollusk in the family Marginellidae, the margin snails. This marine species occurs off...

Crisis at Central High (1981) for TV. She also returned to Broadway for Candida (1981–1982), a production directed by Michael Cristofer that was filmed...

Megachile candida is a species of bee in the family Megachilidae. It was described by Smith in 1879. "Megachile". BioLib. 2014. Retrieved 10 October 2014...

in 1978 as Candida stellata by Yarrow and Meyer. In 2018, a number of Candida yeasts were transferred to the Starmerella genus, where Candida stellata was...

Sallis, Rosamund Greenwood and Michael Brennan in the television film Candida, which was her first lead acting role. In the 1960s Craig appeared in British...

used in Candida albicans. Endomycetales (yeasts): Candida albicans, Candida cylindracea, Candida melibiosica, Candida parapsilosis, and Candida rugosa...

Cancellaria candida is a species of sea snail, a marine gastropod mollusk in the family Cancellariidae, the nutmeg snails. Cancellaria candida Sowerby, 1832...

cernuus Haw. Ajax moschatus (L.) Haw. Ajax tortuosus (Haw.) Haw. Hermione candida M.Roem. Moskerion moschatum (L.) Raf. Narcissus albescens Pugsley Narcissus...

Haemonides candida is a moth in the Castniidae family. It is found in Peru and Guyana. Haemonides candida candida (Peru) Haemonides candida houlbertina...

Enterprises, and Daniel March and Klaus Zimmerman for Dynamic Television. Candida Julian-Jones is series producer. Support also came from Northern Ireland...

Dalea candida var. oligophylla, the western prairie clover, is a perennial plant in the legume family (Fabaceae) found in the Colorado Plateau and Canyonlands...

Cándida María de Jesús (31 May 1845 – 9 August 1912), born in Andoain, as Juana Josefa Cipitria y Barriola, was a Spanish nun and the founder of the Daughters...

Teodorovici anunţă că va candida la Preşedinţia României". Mihai Simionescu (26 November 2023). "Eugen Teodorovici a anunțat că va candida la președinția României...

mid-life crisis of an estranged Candida, when she moves to a rundown London apartment. The novel largely follows Candida's evasive and sometimes deceptive...

Congenital cutaneous candidiasis is a type of candida infection in newborn babies, which appears as generalized red patches and small bumps on the skin...

more persistent. Leaf color ranges from the bright grassy green of Z. candida to rather broad glaucous colored foliage such as found in Z. drummondii...

Parapoynx candida is a moth in the family Crambidae. It was described by Ping You and Hou-Hun Li in 2005. It is found in China. "GlobIZ search". Global...

Catherine Mackin Marc Samuelson Bea Tammer Producers Patricia Rybarczyk Candida Julian-Jones Running time 90 minutes Production company Route 24 Original...

Aechmea candida, the white bromeliad, is a species of bromeliad in the genus Aechmea. This species is endemic to Brazil, where it can be found in Bahia...

Retrieved 23 September 2021. "Candida Baker". Candida Baker. 30 November 2018. Retrieved 17 November 2025. "Meet Candida Baker - Raindrum Team". Retrieved...

protagonist is Candida, she does not really come into her own until the third act. But, Cornell essentially re-envisioned the play. She made Candida the core...

cremated and his ashes were spread on Fort Bravo, Tabernas. He was married to Cándida López Cano (1936-2013) in 1964, with whom he had a son, and Sergio Leone...

(anamorph) reproductive stages known as M. manginii and Scopulariopsis candida, respectively. Several synonyms appear in the literature because of taxonomic...

II Aldoino Filangieri di Candida (d. 1283), son of Giordano II; founder of the Candida branch Riccardo Filangieri di Candida (d. 1321) Guido Filangieri...

The Church of St Candida and Holy Cross is an Anglican church in Whitchurch Canonicorum, Dorset, England. A Saxon church stood on the site but nothing...

clinical context, it is sometimes referred by its synonym from the genus Candida, Candida lipolytica. In January 2019, Yarrowia lipolytica yeast biomass was...

p. 248. ISBN 978-1-592-40464-3. Cox, David J.; Stevenson, Kim; Harris, Candida; Rowbotham, Judith (12 June 2015). Public Indecency in England 1857–1960:...

Ana Cândida Perez (born 1 March 1953 in Porto Alegre, Rio Grande do Sul, Brazil) is a retired Brazilian diplomat. She was the Consul-General in Shanghai...

Polycarpaea candida Webb & Berthel. (1840) Polycarpaea candida var. diffusa Pit. (1909) Polycarpaea candida var. pygmaea Pit. (1909) Polycarpaea candida var....

nuclear ribosomal RNA gene. The two isolated strains clustered within the Candida membranifaciens clade, with C. tumulicola as the most closely related species...

isotomid Folsomia candida. These tests have been standardized. Details on a ringtest, on the biology and ecotoxicology of Folsomia candida and comparison...

as The Mindbenders ("A Groovy Kind of Love"), Tony Orlando and Dawn ("Candida"), and Checkmates, Ltd. ("Black Pearl") in the late 1960s and 1970s. Wine...

inexperienced scholars to analyze ancient texts" according to scholars Candida Moss and Joel Baden in the book Bible Nation. The Museum of the Bible's...

8 July 2008 (2008-07-08) 107 Featured actress: Dayamanti Quintanar 8 8 "Cándida, Esperanzada" María Fernanda Suárez 10 July 2008 (2008-07-10) 108 Featured...

Bradley Louise Stutton Yvonne Francas Sue Howells Ella Kelly Jim Poyser Candida Julian-Jones Jon Zarych Joanna Hanley Ray McBride Emma Grazette Production...

Arum lily, Araceae, Zantedeschia species Autumn zephyrlily, Zephyranthes candida Aztec lily, Sprekelia species Bead lily: Clintonia Clintonia andrewsiana...

Binomial name Calycophyllum candidissimum (Vahl) DC. Synonyms Macrocnemum candidissimum Vahl Mussaenda candida Poir. Mussaenda candidissima (Vahl) Schult....

Candida Donadio (October 22, 1929 – January 20, 2001) was an American literary agent. She represented many writers, including Mario Puzo, John Cheever...

Aartsenia candida is a species of sea snail, a marine gastropod mollusk in the family Pyramidellidae, the pyrams and their allies. The species is one...

the Anchor Yale Bible Series from 2008 to 2025, then was succeeded by Candida R. Moss. He was elected to the American Academy of Arts and Sciences in...

Halifax, and St. John's in the spring. * as of the start of the season Notes Candida Clauseri, Mikey Bustos and Billy Klippert advanced to the top 11 of the...

yeast in the genus Osmozyma. It is present, fuchu miso use in the production of xylitol. "Candida mogii". www.mycobank.org. Retrieved 23 April 2024....

Candida Natiello Colosimo (Vietri di Potenza, 17 November 1878 – Florence, 25 April 1972) was an Italian-American painter, student of Howard Helmick,...

Metridium senile (Linnaeus, 1761) Synonyms List Actinia plumosa Actinia candida Müller, 1776 Actinia cereus Müller, 1776 Actinia marginata ambrea Actinia...

Theatre Festival's production of George Bernard Shaw's Candida, in which he played Candida's father, Mr. Burgess. On August of that same year he played...

billionaires (2011) List of longest-serving G8 leaders The World's Billionaires Candida Morvillo (12 June 2023). "Mamma Rosa, mogli, fidanzate (e il ruolo chiave...

returning four core members of Pulp – vocalist Jarvis Cocker, keyboardist Candida Doyle, drummer Nick Banks and guitarist Mark Webber – were joined in the...

Aires' vibrant theatre, where she developed two satirical characters, Cándida and Catita; by then, she had adopted another pseudonym: "Niní Marshall...

Palicourea candida is a species of plant in the family Rubiaceae. It is endemic to Ecuador. de los Ángeles La Torre Cuadros, M.; Baldeón, S.; Beltran...

"Candida" is an episode of the Australian television series The General Motors Hour, that aired on 5 August 1962. It was an adaptation of the play Candida...

as first class passenger Jack Thayer Steffan Boje as Cosmo Duff-Gordon Candida Gubbins as Lucy, Lady Duff-Gordon Vicky Allen as stewardess Violet Jessop...

Frank C. Odds was an English mycologist. He studied Candida albicans, establishing how modern researchers study fungal pathogens and the diseases they...

Saint Candida (Spanish:Santa Cándida) is a 1945 Argentine comedy film of the classical era of Argentine cinema, directed by Luis César Amadori and starring...

water, salt, and fermented cabbage or kale, is falsely claimed to expunge Candida (a yeast) and parasitic worms. Scientific evidence has shown that this...

appeared on the Great White Way as Miss Proserpine Garnett in the play Candida in 1981. She later went on to be a replacement actress in two other plays...

cast 1946 Truckline Cafe Sage McRae Original cast A Flag Is Born David Candida Eugene Marchbanks Antigone Messenger 1947 Eagle Rampant (The Eagle Has...

Mycostatin among others, is an antifungal medication. It is used to treat Candida infections of the skin including diaper rash, thrush, esophageal candidiasis...

Genus: Crambidia Species: C. casta Binomial name Crambidia casta (Packard, 1869) Synonyms Lithosia casta Packard, 1869 Lithosia candida H. Edwards, 1873...

kind of satirical commentary on Shaw's own highly successful earlier play Candida (which one of the characters gets tickets to see). It was first performed...

clumping habit and blooms with yellow flowers. As its synonym Faucaria candida, white tiger jaws, it has gained the Royal Horticultural Society's Award...

Ludwig & Mayer Typefoundry) - an ultra-bold design similar to Feder-Grotesk Candida (1936, Ludwig & Mayer Typefoundry) - a decorative geometric serif typeface...

Aguas Cándidas is a municipality and town located in the province of Burgos, Castile and León, Spain. According to the 2004 census (INE), the municipality...

Patriarch Michael I Cerularius was officially delivered by Humbert of Silva Candida, the envoy of Pope Leo IX in 1054, an act considered the start of the East–West...

Jackson 5 16 "The Love You Save" 17 "Cracklin' Rosie" Neil Diamond 18 "Candida" Dawn 19 "Thank You (Falettinme Be Mice Elf Agin)" Sly & the Family Stone...

Buddleja candida is a small deciduous shrub widely distributed from north-east India through south east Xizang (Tibet) to the provinces of Sichuan and...

Marchbanks in George Bernard Shaw's Candida at The Yvonne Arnaud Theatre, Guildford. Petula Clark was in the title role of Candida and the production was directed...

growth of pathogens, particularly when hygiene is poor. Yeasts, especially Candida albicans, are the most common penile infection and are rarely identified...

Green, Candida (Ed.) (Methuen, 1994). Letters: John Betjeman, Vol.1, 1926 to 1951. London: Methuen. ISBN 0-413-77595-X Lycett Green, Candida (Ed.) (Methuen...

ended on 22 October 2025. The telenovela is written by Inês Gomes and Cândida Ribeiro with the collaboration of Ana Casaca, Ana Vasques, Filipa Poppe...

and antifungal activity in rats infected with Aspergillus fumigatus or Candida albicans". International Journal of Pharmaceutics. 372 (1–2): 76–84. doi:10...

with HIV/AIDS, and is believed to result from subgingival colonisation by Candida species—particularly in patients with compromised neutrophil function....

can act against fluconazole-resistant strains of Candida albicans as well as other types of Candida: C. glabrata, C. krusei, C. parapsilosis and C. tropicalis...

Subcancilla candida is a species of sea snail, a marine gastropod mollusc in the family Mitridae, the miters or miter snails. The length of the shell...

On Broadway, she played "Prossy" in Katharine Cornell's production of Candida. She made her film debut in John Ford's The Long Voyage Home as a Cockney...

maint: url-status (link) Merlini, Marco (11 December 2025). "Forchielli si candida a sindaco: boccia Lepore e guarda subito a destra" [Forchielli is running...

Turbonilla candida is a species of sea snail, a marine gastropod mollusk in the family Pyramidellidae, the pyrams and their allies. This marine species...

Paraesylacris candida is a species of beetle in the family Cerambycidae. It was described by Martins and Galileo in 2001. BioLib.cz - Paraesylacris. Retrieved...

the development of a biosensor for estrogens in environmental samples. Candida boidinii is a yeast notable for its ability to grow on methanol (called...

pronunciation: [ʒɐnuˈaɾiɐ mɐˈɾiɐ]; Januária Maria Joana Carlota Leopoldina Cândida Francisca Xavier de Paula Micaela Gabriela Rafaela Gonzaga; 11 March 1822...

pullulans Aureobasidium oleae Aureobasidium pullulans Azymocandida malicola Candida malicola Cladosporium pullulans Dematium pullulans Exobasidium vitis Hormonema...

Tentori. Porn'Italia. Nuovi Equilibri, 2004. "Roma, Milly D'Abbraccio si candida". Corriere della Sera. 15 March 2008. Retrieved 27 February 2012. Andrea...

ochraceus (yellow), Aureobasidium pullulans (black), Candida albicans (whitish buff), Candida sake, Candida sp. (whitish), Cladosporium herbarum (brown to black)...

Gonzaga .... Dona Ló 2000 - Uga-Uga .... Santa 2000 - A Muralha .... Mãe Cândida Olinto 2001 - Presença de Anita .... Marta 2002 - Desejos de Mulher .....

v t e Pulp Jarvis Cocker Nick Banks Candida Doyle Mark Webber Simon Hinkler Antony Genn Russell Senior Steve Mackey Studio albums It Freaks Separations...

these comments, Biblical scholars Joel Baden of Yale Divinity School and Candida Moss of University of Birmingham, who wrote the book Bible Nation: The...

Archived from the original on 23 May 2021. Retrieved 23 May 2021. "Clemente candida Napoli per l'Eurovision 2022". casoriadue.it (in Italian). 23 May 2021...

S2CID 144058326. De Jong AR (1985). "Vaginitis due to Gardnerella vaginalis and to Candida albicans in sexual abuse". Child Abuse & Neglect. 9 (1): 27–9. doi:10...

Linares / Rogelio Linares Laura Zapata as Dulcina Linares Liliana Abud as Cándida Linares Claudio Báez as Federico Robles Armando Calvo as Sebastián Josefina...

Cryptococcus neoformans Candida auris Aspergillus fumigatus Candida albicans Cryptococcus neoformans Candida auris Aspergillus fumigatus Candida albicans Nakaseomyces...

Galina Petukhova 2–0 Alise Misane – Sofia Pandolfo 1–1 Saiya Gangsuhe – Candida Joaquin 2–0 Yulia Makarenkova – Elena Panchoo 2–0 Saiya Gangsuhe – Olga...

Hyphantria punctata Fitch, 1857 Hyphantria pallida Packard, 1864 Spilosoma candida Walker, [1865] Hyphantria suffusa Strecker, 1900 Hyphantria brunnea Strecker...

Solanaceae: Brugmansia, woody plants with pendulous flowers Brugmansia × candida, a widespread garden plant Datura, herbaceous plants with erect flowespines...

tenax. Genera of fungi that are frequently found in the mouth include Candida, Cladosporium, Aspergillus, Fusarium, Glomus, Alternaria, Penicillium,...

incrustans (Johnston, 1842) Halichondria batei Bowerbank, 1866 Halichondria candida Bowerbank, 1866 Halichondria incrustans Johnston, 1842 Halichondria irregularis...

Candida Cave is a British painter, playwright and art historian. In 1978, she and artist Nicholas Cochrane founded Hampstead Fine Arts College, an independent...

unavailable. The cast featured Irish soprano Margaret Burke Sheridan as Candida, tenor Francesco Merli as her lover Baldo, and baritone Mariano Stabile...

Gradual (chronic) occurrences are typically caused by fungi, commonly Candida albicans. Risk factors for paronychia include frequent hand washing and...

"for her special dedication to social causes", Carla Castro and Eugénia Cândida da Fonseca da Silva Mendes. Portuguese businessmen include Raul Pires Ferreira...

vaginal region. An example of a condition they are sometimes used for is candida vulvovaginitis which is treated with intravaginal Clotrimazole. This is...

Current Assumed role 16 August 2020 President Luis Abinader Preceded by Cándida Montilla de Medina Personal details Born Raquel Patricia Arbaje Soneh (1970-09-21)...

Cândida Ventura (30 June 1918, Maputo, Mozambique – 16 December 2015, Portimão, Portugal) was a political activist against the Portuguese Estado Novo...

tourism". The song was written by the band members Jarvis Cocker, Nick Banks, Candida Doyle, Steve Mackey and Russell Senior. Cocker had conceived the song after...

placed in Calonyction and now in genus Ipomoea, Ipomoea muricata, Datura candida, Brugmansia suaveolens, and Selenicereus wittii. The similar "moon-flower"...

the Atlantic white tern (Gygis alba), the blue-billed white tern (Gygis candida) and the little white tern (Gygis microrhyncha). del Hoyo, J; Collar, N...

team of readers, which adds layers to how Paul's letters were composed. Candida Moss has argued that enslaved and formerly enslaved secretaries played...

species of fungus in the family Tetragoniomycetaceae, first described as Candida marina in 1962. It is currently the only species in the monotypic genus...

Bronchomoniliasis is an infection of the lungs caused by Candida albicans or another fungus in the genus Candida. The infection is more likely to be seen in immunocompromised...

includes indication for the treatment of candidemia and some specific Candida infections (intra-abdominal abscesses, peritonitis, pleural cavity infections...

is a quick, inexpensive fungal test to differentiate dermatophytes and Candida albicans symptoms from other skin disorders like psoriasis and eczema....

henchwoman Evil Thoughts Paola 1972 Avanti! Nurse 1972 Man of the East Candida Olsen 1971 Trinity Is Still My Name Trinity's girl, the farmer's daughter...

major shrine was at Whithorn in Galloway, where he is associated with the Candida Casa (Latin for 'White House'). Nothing is known about his teachings, and...

interruptella (Walker, 1866) Synonyms Argyria interruptella Walker, 1866 Argyria candida Butler, 1881 Argyria inficitella Walker, 1866 Argyria obliquella Zeller...

candida vulvovaginitis. Women may also experience burning, soreness, irritation, pain during urination, or pain during sex. The diagnosis of Candida vulvovaginitis...

12000T). Correia, A. (2006). "Candida bracarensis sp. nov., a novel anamorphic yeast species phenotypically similar to Candida glabrata". International Journal...

shiny. Bacterial, viral or fungal infections can cause glossitis. Chronic Candida infections of the tongue can cause an atrophic glossitis known as median...

discovers that her husband is enjoying similar activities of his own. Candida Royalle as Guest #19 Désirée Cousteau as Girl in Bar Dominique Saint Claire...

Candida Raymond (1950 – c. December 2025) was an Australian actress, most prominent in film and television during the 1970s and early 1980s. Raymond was...

it all back again : the way of living generously. OCLC 952980261. Moss, Candida R.; Baden, Joel S. (2017). Bible nation: the United States of Hobby Lobby...

del Consiglio Grande e Generale". Dire. Retrieved 12 March 2026. "Libera candida Vladimiro Selva alla suprema magistratura". San Marino RTV (in Italian)...

to Neptali Gonzales II, with whom she has twins, Neptali III and Isabel Candida. "HOR_L_GONZALES_ALEXANDRIA_P.pdf" (PDF). Commission on Elections. Retrieved...

Epichorista candida. In 1928 Alfred Philpott also discussed and illustrated the male genitalia of this species. Hudson synonymised Epichorista candida with Epichorista...

Giardia length 10-20 μm Giardia lamblia Fungus Candida albicans Yeast infection diameter 10-12 μm Candida albicans Bacterium Borrelia burgdorferi Lyme disease...

José Carvalho da Rocha and the minister of Science and Technology, Maria Cândida Pereira Teixeira, states that "under the massification" of that Angolan...

Italian nuns Giulia Salzano and Camilla Battista da Varano; Spanish nun Candida Maria de Jesus Cipitria y Barriola; and the first Australian saint, Mary...

Dactylethrella candida is a moth in the family Gelechiidae. It was described by Stainton in 1859. It is found in Sri Lanka and southern India. The wingspan...

Leucorhynchia candida is a species of sea snail, a marine gastropod mollusk in the family Skeneidae. This marine species occurs off Japan. Bouchet, P...

Saccharomyces rosei or Saccharomyces roseus, and the anamorph is called Candida colliculosa (for a complete list of synonyms, see CBS's website). Torulaspora...

Eulepidotis candida is a moth of the family Erebidae first described by Constant Bar in 1876. It is found in the Neotropical realm, including French Guiana...

albida Bateman ex Lindl. Synonyms Laelia discolor A.Rich. & Galeotti Laelia candida Lodd. ex W. Baxter Amalia albida (Bateman ex Lindl.) Heynh. Cattleya albida...

Gwen Teirbron (French: Blanche; Latin: Alba Trimammis or Candida; possibly English: Wite) was a Breton holy woman and wife of Fragan who supposedly lived...

Pediococcus and Leuconostoc bacteria, with yeasts from Saccharomyces, Candida, Kloeckera and possibly others. Lactobacillus brevis bacteria has been...

the age of 49. His grave is in a small churchyard at the Church of St Candida and Holy Cross in Whitchurch Canonicorum. Bernard Riley, the physician...

Taxon identifiers Candida rhizophoriensis Wikidata: Q27996318 EoL: 42731669 IndexFungorum: 517490 MycoBank: 517490 NCBI: 746466 Open Tree of Life: 10417...

(most species of Candida, but not Cryptococcus, Trichosporon, and Rhodotorula). Echinocandins also have displayed activity against Candida biofilms, especially...

Pfeiffer, 1852 Synonyms List Partula callifera L. Pfeiffer, 1857 Partula candida H. E. Crampton, 1956 Partula cedista H. E. Crampton, 1956 Partula citrina...

Vietnamese Yorùbá Alternative diagnoses Adrenal fatigue Aerotoxic syndrome Candida hypersensitivity Chronic Lyme disease Electromagnetic hypersensitivity...

molds and fungi that are able to exist as both a mold and yeast. The yeast Candida albicans can live in people without producing symptoms, and is able to...

Aitken), Helena in A Midsummer Night's Dream at The Old Globe Theatre, Candida in Candida and Rosalind (As You Like It) at Pittsburgh Public Theater, Emily...

atlases. In 2005, Myriad began publishing under its own imprint, with Candida Lacey as Publishing Director. With its stated aim being "to showcase new...

Persecution: How Early Christians Invented a Story of Martyrdom is a 2013 book by Candida Moss, an award-winning historian and professor of New Testament and Early...

before it was protected. Nymphaea candida J. Presl is sometimes considered a subspecies of N. alba (N. alba L. subsp. candida (J. Presl) Korsh.). Nymphaea...

Cameron, and Peter Garnsey. Cambridge University Press. ISBN 0-521-30199-8. Candida Moss (2013). The Myth of Persecution. HarperCollins. pp. 145–151. ISBN 978-0-06-210452-6...

Trupanea candida is a species of tephritid or fruit flies in the genus Pliomelaena of the family Tephritidae. Argentina. Hering, E.M. (1942). "Neue Gattungen...

Charisma candida is a species of extremely small sea snail, a marine gastropod mollusk in the family Trochidae, the top snails. (original description...

castellii TCTGGGTG Candida glabrata GGGGTCTGGGTGCTG Candida albicans GGTGTACGGATGTCTAACTTCTT Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT Candida maltosa...

infection with bacteria (such as Corynebacterium minutissimum), fungi (such as Candida albicans), or viruses. A frequent manifestation is candidal intertrigo...

Thérèse of Lisieux. Authors such as Concepción Cabrera de Armida and Maria Candida of the Eucharist have produced writings recording their Eucharistic meditations...

Broadway stage management credit is the 1981 revival of George Bernard Shaw's Candida at Circle in the Square, starring Joanne Woodward. His subsequent twenty-five...

Antennaria media Greene Synonyms Antennaria austromontana E.E.Nelson Antennaria candida Greene Antennaria densa Greene Antennaria gormanii H.St.John Antennaria...

Empire Candida was a 2,908 GRT cargo ship which was built in 1942 for the Ministry of War Transport (MoWT). She was sold in 1947 and renamed Burdale and...

Order: Cornales Family: Hydrangeaceae Genus: Hydrangea Species: H. coenobialis Binomial name Hydrangea coenobialis Chun Synonyms Hydrangea candida Chun...

Featuring Litany Burns, author of Develop Your Psychic Abilities. TBA "Candida and PMS" 20 September 1990 TBA 02-xxx Featuring immune system specialist...

Lophohelia tenuis Moseley, 1881 Madrepora alcocki Faustino, 1927 Madrepora candida (Moseley, 1881) Madrepora kauaiensis Vaughan, 1907 Madrepora tenuis (Moseley...

Canbya Pygmy poppy (Canbya candida) Scientific classification Kingdom: Plantae Clade: Embryophytes Clade: Tracheophytes Clade: Spermatophytes Clade: Angiosperms...

Publico Distrito Yamasa Prof. Brigido Nolasco Publico Distrito Moca Prof. Candida Silvia Santiago Publico Jima Abajo Prof. Carlos Manuel Medina Cruz Publico...

colitis promotes opportunistic human fungal pathogen Candida albicans colonization. In turn, Candida albicans colonization generates ASCA. According to...

Maria Cândida Parreira (16 January 1877 - 28 July 1942) was a lawyer, politician and writer linked to the Estado Novo regime in Portugal. She was one...

Grazia Cucinotta as Anna Lazar Ristovski as Fosco Giorgio Noè as Livio Candida Vettori as Stella Jessica Auriemma as Santina Sergio Pierattini as Uncle...

species "White Rusts of Vegetables" (pathology), University of Illinois Pest and Pathogen Management Database Albugo candida Integrated Pest Management...

corrodenes, Candida Hemodialysis patients S. aureus, coagulase-negative staphylococci, enterococci, aerobic gram negative bacilli, Candida Patients with...

recovery from heart disease, diabetes, hormonal imbalance, chronic fatigue, candida albicans (fungus), drug addiction, cancer, heartburn, and obesity. She...

Adhesins also have other functions, such as mating and biofilm formation. Candida albicans can cause opportunistic oral and genital infections in humans...

feces, was reported to potentially prevent opportunistic infections by Candida albicans, a main causing agent of candidiasis in humans. Arxiozyma heterogenica...

neroli, and champaca. It is also an autoantibiotic produced by the fungus Candida albicans. Fusel alcohols like phenethyl alcohol are grain fermentation...

org:names:77101361-1 Species+: 69455 Tropicos: 100463726 WFO: wfo-0000914236 Piperia candida Wikidata: Q19848294 Calflora: 6529 CoL: 7NJG8 CNPS: 728 FNA: 242101815...

Epideira candida is a species of sea snail, a marine gastropod mollusk in the family Horaiclavidae. This marine species is endemic to Australia and occurs...

the mitochondrial genome of yeasts, notably Saccharomyces cerevisiae, Candida glabrata, Hansenula saturnus, and Kluyveromyces thermotolerans.    AAs...

Funny Cars: Part 2" in Drag Racer, November 2016, p. 46 caption. Benson, Candida (2017-01-30). "High-Profile First Wins at the Winternationals | Connie...

Alicia Rio 2004 Olivia Del Rio 2025 Jace Rocker 1998 Kristina Rose 2022 Candida Royalle Ruby 2008 Tina Russell 2026 Will Ryder 2015 Sinn Sage 2024 Silvia...

17 October 1965 17 July 2005 Cambridge Spies One 9 May 2003 30 May 2003 Candida 29 December 1961 Candy Cabs 5 April 2011 19 April 2011 Canned Carrott 3...

microbiome more susceptible to infections. In children and adolescents, Candida albicans can be present, but it was found to be more common postmortem...

Vietnamese Yorùbá Alternative diagnoses Adrenal fatigue Aerotoxic syndrome Candida hypersensitivity Chronic Lyme disease Electromagnetic hypersensitivity...

well as playing the role of Eugene Marchbanks in the 2008 production of Candida at the Berkshire Theatre Festival. He later portrayed Damon Miller in the...

fuggi fuggi là dove il Verno su le brine ha seggio eterno. Vieni vieni candida vien vermiglia tu del mondo sei maraviglia Tu nemica d'amare noie Dà all'anima...

composed by Jarvis Cocker, Russell Senior, Steve Mackey, Nick Banks and Candida Doyle. 12" vinyl "Babies" – 4:07 "Styloroc (Nites of Suburbia)" – 3:13...

(=CBS 10003T =NRRL Y-27812T). Ruivo, C. C. C. (2005). "Candida bromeliacearum sp. nov. and Candida ubatubensis sp. nov., two yeast species isolated from...

Achatinella (Bulimella) candida L. Pfeiffer, 1855 alternative representation Achatinella (Bulimella) elegans Newcomb, 1854 Achatinella candida L. Pfeiffer, 1855...

and virulence of Candida albicans in both the vagina and the gut. Fungal genera that have been detected in the vagina include Candida, Pichia, Eurotium...

run by the nuns of the Congregation of the Hijas de Jesus, founded by Candida Maria de Jesus. Manresa School offers education in the Preschool (Nursery...

Vietnamese Yorùbá Alternative diagnoses Adrenal fatigue Aerotoxic syndrome Candida hypersensitivity Chronic Lyme disease Electromagnetic hypersensitivity...

are most commonly caused by different Candida species, such as Candida albicans, Candida glabrata and Candida tropicalis resulting in oral candidiasis...

genus Candida". Antonie van Leeuwenhoek. 35 (4): 433–462. doi:10.1007/bf02219163. di Menna ME (1966). "Three new yeasts from Antarctic soils: Candida nivalis...

Candida bromeliacearum is a yeast species. Its type strain is UNESP 00-103T (=CBS 10002T =NRRL Y-27811T). Ruivo, C. C. C. (2005). "Candida bromeliacearum...

her Heartless Grandmother (Spanish: La increíble y triste historia de la cándida Eréndira y de su abuela desalmada) is a 1972 novella by Colombian writer...

Worcester United Kingdom Information Type Private girls' secondary Motto Candida Rectaque Established 1883–2007 merger with RGS Worcester Founder Canon...

Epidendrum loddigesii (Lindl.) Rchb.f. Cattleya arembergii Scheidw. Cattleya candida F.N. Williams Epidendrum harrisonianum Rchb.f. Cattleya obrieniana Rolfe...

Afrodite Superstar was directed by Venus Hottentot. Executive producer Candida Royalle is credited with directing the sexual scenes. The satirical film...

after the end of which she took part in the film Urban & the Shed Crew, by Candida Brady. In 2018, she starred in a theatre production I Told My Mum I Was...

of the Aberdeenshire branch of the Scottish Clan Leslie. Her mother is Candida Mary Sibyl "Candy" Leslie (née Weld) of Clan Fraser of Lovat, whose maternal...

and provides an advantage of sex that does not depend on outcrossing. Candida albicans is a diploid fungus that grows both as a yeast and as a filament...

Vietnamese Yorùbá Alternative diagnoses Adrenal fatigue Aerotoxic syndrome Candida hypersensitivity Chronic Lyme disease Electromagnetic hypersensitivity...

is best known for the motion analysis of living cells, the discovery of Candida albicans phenotypic switching and monoclonal antibody technology. Soll...

Oenopota candida is a species of sea snail, a marine gastropod mollusk in the family Mangeliidae. The length of the shell attains 7 mm. This is an Asian...

Cylindrocarpon ehrenbergii Wollenw., (1926) Fusarium candidum Ehrenb., (1818) Neonectria ramulariae Wollenw., (1917) Ramularia candida (Ehrenb.) Wollenw....

published in 1898 as part of Shaw's Plays Pleasant volume, which also included Candida, You Never Can Tell, and The Man of Destiny. Arms and the Man was one of...

the original (PDF) on 3 March 2016. Retrieved 22 September 2012. Leite, Cândida Mara Britto (2010). "O /r/ em posição de coda silábica na capital do interior...

Chiaromonte), and that he had been assisted by his talented assistant Giulio Candida. He was a member of the Royal Institute of Encouragement to Natural Sciences...

also been shown that not only bacteria but also pathogenic fungi such as Candida albicans induce neutrophils to form NETs that capture and kill C. albicans...

Doherty 58 WTC Hartsdale New York United States vice president Aon Melissa Cándida Doi 32 WTC Throggs Neck New York United States manager IQ Financial Systems...

producer was Joan Shigekawa with associate producers Susan Lester and Candida Harper, and field producer Joan Fiore. The pilot episode consisted of several...

Orchid House Natalie Miniseries; episode: "Natalie" 1992 The Good Guys Candida Ashton Episode: "Relative Values" The Young Indiana Jones Chronicles Vicky...

Old Style Berling Beton Book Antiqua (Monotype's imitation of Palatino) Candida Cartier Caslon Antique Catull Century Old Style Charis SIL Cholla Slab...

Christianity. Cambridge University Press. ISBN 978-1-139-05483-6. Moss, Candida R. (2012). Ancient Christian Martyrdom: Diverse Practices, Theologies,...

(glycoprotein) located on the surface of an opportunistic diploid fungus called Candida albicans. This "hyphal" denomination is due to Hwp1 appearing exclusively...

Laboratories. It is marketed as an enzymatic remedy to treat the yeast infection candida. Having the status of a dietary supplement, its efficiency has not been...

they left home".[better source needed] In July 2013, Dillane played in Candida at Theatre Royal, Bath, directed by Simon Godwin. In 2014, he played the...

yeasts (e.g., of the genera Saccharomyces, Kluyveromyces, Pichia, and Candida), and many filamentous fungi living as saprotrophs, parasites, and mutualistic...

Berkeley, but was turned down. In an April 1964 letter to his agent, Candida Donadio, Pynchon wrote that he had four novels in progress, announcing:...

pornographic film industry, including Gloria Leonard, Veronica Vera and Candida Royalle created the first female adult performer emotional support organization...

Bankole 2:28 17. "Begging for Change" (Pulp) Adam Betts Andrew McKinney Candida Doyle Emma Smith Jarvis Cocker Jason Buckle Mark Webber Nick Banks Raval...

2016), Geraldine James (in the film version of Downton Abbey, 2019), and Candida Benson (in The Crown, 2022). Many places and buildings have been named...

Joaquim Hilário Nakombe Adelino Caracol Paulo Almeida Sílvio Nascimento Cândida Pereira Ilda Costa Kleyde Miranda Henza Benchimol / Maya Zuda Sheila Gaspar...

Modeling and Acting School in that city. Prior to her recurring role as Candida Keegel in Phil of the Future in 2005, Locke had a recurring role as Bitsy...

archives Established 22 December 1808; 217 years ago (1808-12-22) Director Candida Carrino Building information Building Santi Severino e Sossio Website http://www...

(Thouars) Kuntze (1891) Bletia sylvatica (Thouars) Bojer (1837) Calanthe candida Bosser (1989) Calanthe corymbosa (Thouars) Lindl. (1862) Calanthe curtisii...

bulbocodioides var. minor Bég. Romulea bulbocodioides var. viridiflora Bég. Romulea candida (Ten.) Ten. Romulea caulescens (Ker Gawl.) Klatt Romulea cruciata var....

Eugénia Cândida da Fonseca da Silva Mendes (died 1843) was a Portuguese baroness and landowner. She was born to José António da Fonseca and Perpétua Maria...

Infanta 1957: Hamlet 1957: Pelléas and Mélisande 1957: Metamorphosis 1957: Candida 1957: World Famous Dramatic Recitals 1957: Pale Horse, Pale Rider 1957:...

onychomycosis are all in the fungus kingdom and include dermatophytes, Candida (yeasts), and nondermatophytic molds. Dermatophytes are the fungi most...

Marchbanks in the Vancouver Playhouse production of George Bernard Shaw's Candida, for which he received a Jessie Richardson award for best performance by...

by MC Frontalot from the 2008 album Final Boss Canada (disambiguation) Candida (disambiguation) This disambiguation page lists articles associated with...

nipple pain. It happens when the infant's mouth is infected by a Candida species called Candida albicans, the child may transmit the yeast to the mother's nipple...

Services Preceding station Rome Metro Following station Due Leoni-Fontana Candida towards Colosseo Line C Bolognetta towards Monte Compatri-Pantano Location...

Synonyms Clypidina candida Adams, 1851 Emarginula nesta Pilsbry, 1890 (original combination) Nesta candida Adams, 1870 Zeidora candida (Adams, 1870)...

Teresa Villanueva 2. Felix Manalo 20. Manuel Manalo 10. Andres Manalo 21. Candida Torres 5. Bonifacia Manalo 11. Maria Cruz 1. Pilar Manalo 12. Arsenio de...

resinae, Bacillus submarinus, Micrococcus varians, Pseudomonas aeruginosa, Candida marina and Saccharomyces estuari. James S. Robbins has argued that the...

Katharine Cornell in such plays as Romeo and Juliet, Antony and Cleopatra, and Candida. In 1930, Theatre Guild's production of Roar, China! was Broadway's first...

skin flora. Fluoridated toothpaste and some micro-organisms, including Candida, may also worsen the condition, but their roles in this condition are unclear...

the tailors Ede & Ravenscroft. Lycett Green was married to the writer Candida Lycett Green, daughter of the poet John Betjeman, until her death on 19...

The White Ship (French: la Blanche-Nef; Medieval Latin: Candida navis) was a vessel transporting many nobles, including the heir to the English throne...

Cándida Martínez López (born 6 December 1951) is a Spanish historian, university professor, expert in women's history and studies, and politician. From...

Performer: Jasper de Waal. Orchestra: Amsterdam Sinfonietta. Conductor: Candida Thompson. Singer: James Gilchrist. Joaquín Rodrigo Adagio (Concierto de...

a PhD from UWA in 2010 for her thesis, "Pathogenic behaviour of Albugo candida on Brassica juncea and mechanisms of host resistance". She said that her...

Trichosporon asahii is a non-Candida yeast that has been reported to cause infections in immunocompromised patients. T. asahii is the most prominent human...

Fond du Lac Band of Lake Superior Chippewa Known for Inventor of the technology associated with the development of the Smart Grid Spouse Candida Stevens...

skin or gut colonization with Staphylococcus aureus, Malassezia spp., and Candida albicans. Guttate psoriasis often affects children and adolescents and...

Cutaneotrichosporon curvatum (Diddens & Lodder) Yurkov, Xin Zhan Liu, F.Y.Bai, M.Groenew. & Boekhout Synonyms Candida heveanensis var. curvata Cryptococcus curvatus...

original (PDF) on 16 March 2018. Retrieved 15 March 2018. Zamith, Maria Cândida; Flora, Luísa, eds. (2007). Virginia Woolf: Three Centenary Celebrations...

data about the safety of the drug. Olorofim does not inhibit growth of Candida species. Neoh, Chin Fen; Jeong, Wirawan; Kong, David CM; Slavin, Monica...

margin are black. Milleria adalifa adalifa (India, Burma) Milleria adalifa candida (Snellen van Vollenhoven, 1863) (Sumatra, Java) Milleria adalifa fuhoshonis...

Forsyte Saga (2002) as Imogen (2 episodes) Where the Heart Is (2003) as Candida Oliver-Watts (3 episodes) The Last King (2003) as Lady Frances Stewart...

him in three plays. Romeo and Juliet, The Barretts of Wimpole Street and Candida began touring in repertory in November 1933, with the first of more than...

differ as to its actual location. Two locations much discussed are Ninian's Candida Casa at Whithorn in Scotland, and Ty Gwyn overlooking Whitesands Bay (Pembrokeshire)...

property has supported its investigation for the treatment of deep-seated Candida infections, including osteomyelitis. Rezafungin was approved for medical...

Aspidopholas yoshimurai Kuroda & Teramachi, 1930 Genus Barnea Risso, 1826 Barnea candida (Linnaeus, 1758) Barnea davidi (Deshayes, 1874) Barnea fragilis (G. B....

ejaculation occurs. When feminist pornography emerged in 1980s, pioneer Candida Royalle always excluded facial cum shots, and with few exceptions all other...

on Demand. p. 332. ISBN 9783758326264. Ex comandante degli Schuetzen si candida alle provinciali. ANSA "Wirth Anderlan tritt mit eigener Liste zur Wahl...

returned to the theater. His stage roles include Marchbanks in Shaw's Candida, Mercutio in Romeo and Juliet, Morgan Evans in The Corn Is Green, Algernon...

Elms Abbie Putnam 1976–77 The Fatal Weakness Mrs. Espenshade 1977 Candida Candida Morell 1978–79 First Monday in October Judge Ruth Loomis 1982–83 Duet...

environmental documentary film, written and directed by British film-maker Candida Brady. It follows actor Jeremy Irons as he investigates the global scale...

contributes to increased incidence of yeast infections in the mouth (from Candida albicans). People with Down syndrome also tend to have a more alkaline...

of Angola. The position was established in 2002 with Cândida Celeste da Silva. 2002–2010: Cândida Celeste da Silva 2010–2012: Genoveva da Conceição Lino...

Carlo Greg Turvey as Russel Jeff Geronimo as Ray Guest cast Gina Pareño as Candida Sanpiandante Rita Avila as Dolores Amy Austria Odette Khan Maritoni Fernandez...

Greenwood". "The Witches (1989)". Archived from the original on 12 May 2016. "Candida". BBC Genome Project. 29 December 1961. Retrieved 31 December 2025. Rosamund...

PhD degree in 1973 from the University of East Anglia for research on Candida utilis. He then pursued postdoctoral work at the University of Bern, the...

including Gymnogramma. Accordingly, he transferred G. candida to Pellaea section Cincinalis as P. candida in 1882. Maxon and Weatherby placed N. incana within...

activity against many kinds of fungi that may cause human disease, such as Candida, Histoplasma, Coccidioides, and Blastomyces (although it is not active...

known for his molecular and genetic studies of pathogenic yeasts such as Candida and Cryptococcus). An alumnus of Bidhan Chandra Krishi Viswavidyalaya and...

(Lindl.) Rchb.f. Synonyms Pilumna fragrans Lindl. (basionym) Trichopilia candida Linden ex Lindl. Pilumna nobilis Rchb.f. Trichopilia albida H.Wendl. Trichopilia...

acetaldehyde is still considerably lower than any toxicity. The yeast Candida albicans in patients with potentially carcinogenic oral diseases has been...

 martinii Binomial name Melanella martinii A. Adams 1854 Synonyms Melanella candida Marrat, 1880 Eulima candida Marrat, 1880 Eulima martinii A. Adams, 1854...

2024. The telenovela is written by Inês Gomes with the collaboration of Cândida Ribeiro, Rita Roberto, Ana Casaca, Ana Vasques, José Pinto Carneiro e Manuel...

(Fabricius, 1793) Synonyms Papilio absolon Fabricius, 1793 Bebearia (Apectinaria) absolon Euryphene candida Capronnier, 1889 Euryphene entebbiae Lathy, 1906...

Royal Shakespeare Company in the late '80s. Together with fellow actress Candida Gubbins, she formed the theatre company Two Friends Productions in 2000...

Alejandro Peraza as Raúl Ramos Rubén Cerda as Antonino Alejandra Jurado as Cándida Felipe Nájera as Severo Alberto Agnesi as Patrick Alejandro Nones as Waldo...

hinterland: sociolinguistic analysis. Archived 2013-09-26 at the Wayback Machine Cândida Mara Britto LEITE. Page 111 (page 2 in the attached PDF) (in Portuguese)...

toxoplasmosis, cytomegalovirus and candida. Cytomegalovirus retinitis is an important cause of blindness in AIDS patients. Candida spreading to the retina from...

1968 onwards. He is a managing director of the company. He is married to Candida Gertler, an art collector and co-founder of Outset Contemporary Art Fund...

to an aromatic carbon atom. Aromatic alcohols are produced by the yeast Candida albicans. They are also found in beer. These molecules are quorum sensing...

Armstrong as Car Darch Hannah Waterman as Nancy Charlotte Bellamy as Cissie Candida Rundle as Izzy Amanda Brewster as Retty Russell Morgan as Boy with Wheelbarrow...

(1031) Venerable Meletius of Cyprus, Bishop. (see also: September 21) Saint Candida, a virgin-martyr in Carthage in North Africa under Maximian Herculeus (c...

not have cancer or any sexually transmitted disease, but he did have a candida infection, which can be a sign of a weakened immune system. Carter tested...

"Sheffield: Sex City" features a spoken vocal contribution from keyboardist Candida Doyle - reciting a selection from the book My Secret Garden by Nancy Friday...

Binomial name Millepora alcicornis Linnaeus, 1758 Synonyms List Millepora candida Duchassaing & Michelotti, 1864 Millepora carthaginiensis Duchassaing &...

Subspecies I. a. ssp. aggregata I. a. ssp. attenuata I. a. ssp. bridgesii I. a. ssp. candida I. a. ssp. collina I. a. ssp. formosissima I. a. ssp. weberi...

pornography was the US porn star–turned–writer, director and producer Candida Royalle. She produced pornography films aimed at women and their partners...

narrowed, species were even split based on anamorph and teleomorph states. Candida is an example of a genus that separated from the previous Williopsis classification...

White rust is a disease in plants caused by the oomycete Albugo candida or one of its close relatives. Plants susceptible to this disease generally include...

Olinto Pedro Paulo Rangel Mestre Davidão (David Fonseca) Regiane Alves Rosália Olinto Sérgio Mamberti Dom Cristovão Rabelo Vera Holtz Mãe Cândida Olinto...

Archived from the original on 26 August 2022. Retrieved 26 August 2022. (Candida Moss marshals the historical evidence to prove that "we simply don't know...

treatment of vaginal yeast infections such as vulvovaginitis caused by Candida albicans. The term "sulfanilamides" is also sometimes used to describe...

holding onto their diminishing privileges." In 1969, Hamilton married Candida Vargas, granddaughter of Getúlio Vargas, dictator of Brazil. They separated...

the series Bolívar, el hombre de las dificultades(1981). She was María Cándida in La Pezuña del Diablo (1983), Yadira La Ardiente in Caballo Viejo (1988)...

immune disorder of T cells. It is characterized by chronic infections with Candida that are limited to mucosal surfaces, skin, and nails. It can also be associated...

cu cine să votez dintre candidații actuali la prezidențiale. "Poate voi candida chiar eu"". Digi24.ro (in Romanian). 19 January 2025. Archived from the...

a noted film director. Telmo was his best man when he married Clarisse Cândida Garrocho Ventura in Lisbon on 27 October 1921. She came from Olhão in the...

Platanthera heyneana Lindl. Habenaria glabra A.Rich. Habenaria subpubens A.Rich. Habenaria candida Dalzell Habenaria heyneana var. subpubens (A.Rich.) Pradhan...

verso Settentrione, illuminato in modo, che di lucidità non-cede alla piu candida Aurora, ne lontana allo spuntar del Sole; effetto, che per mio credere...

alternating at the Cort Theatre with a revival of Candida, again produced by Cornell and staged by McClintic. Candida starred Cornell as the title character, Hardwicke...

Marília Drummond Limited Series. Main Cast 2017 A Força do Querer Joyce Garcia Telenovela. Main Cast 2024 Renascer Cândida Gouveia Telenovela. Guest Star...

not transpire. Dunkeld Dunkeld Galloway Whithorn earlier cathedral of Candida Casa nearby. Glasgow Glasgow Metropolitan since 1492 Moray Elgin prior...

Pope Francis. Penguin Publishing Group. p. 49. ISBN 978-0-698-15765-1. (Candida Moss marshals the historical evidence to prove that "we simply don't know...

Year Title Role Notes 2006 14 Bis Gisele Short film 2008 Eletrotorpe Clara 2010 Elvis e Madona Cândida 2013 Time and the Wind Luzia Cambará...

should have an ivory coloured wrinkly rind composed mainly of geotrichum candida. The cheese is produced by the lactic fermentation method. Typically cheeses...

West Indies, Rango, Hostages". news.com. Retrieved 31 March 2024. Baker, Candida (25 January 2019). "Indigenous arts supremo Rhoda Roberts". The Sydney...

acid, with Aspergillus niger for the production of gluconic acid, with Candida brumptii to produce isocitric acid, with Aspergillus terreus for the production...

Christianity.... "Professor Candida Moss". birmingham.ac.uk. Retrieved 2018-02-21. Janes & Houen 2014, p. 24: Indeed, a recent study by Candida Moss, The Myth of...

Lisieux Maurice Tornay Agnes Tsao Kou Ying John Baptist Wang Ruohan [pl] Candida Xu St. Andrew's Abbey Our Lady of Joy Abbey Catholic Church in Tibet Protestant...

Clarence Derwent Award for her Broadway debut performance in the play Candida starring Mary Steenburgen. She next appeared in Taking Sides (1996) with...

Vietnamese Yorùbá Alternative diagnoses Adrenal fatigue Aerotoxic syndrome Candida hypersensitivity Chronic Lyme disease Electromagnetic hypersensitivity...

limited, a HVS can be performed and evaluated at the bedside. Using HVS, candida and trichomonas may be diagnosed with a wet mount microscopy. "Investigation...

Floris; Van Dijck, Patrick (7 August 2019). "Protein-Protein Interactions in Candida albicans". Frontiers in Microbiology. 10: 1792. doi:10.3389/fmicb.2019...

December 1970 (8w) "Cracklin' Rosie" Neil Diamond 19 January 1971 (3w) "Candida" Dawn 9 February 1971 (6w) "My Sweet Lord" George Harrison 23 March 1971...

verschlossenen Schatz". Die Zeit (in German). Retrieved 3 April 2025. Morvillo, Candida (16 June 2020). "Bacardi, l'eredità contesa della famiglia del rum. La...

presence prompts young Channe to turn to her protective Portuguese nanny Candida. Initially jealous of her new brother, Channe quickly warms to him, inviting...

fungicidal effect on Streptococcus intermedius, Streptococcus mutans, and Candida albicans and inhibited biofilm formation. Chavicol Atiya A, Sinha BN, Lal...

deficiency. It can be produced from sorbose by the action of the methanol yeast Candida boidinii at a conversion rate upwards of 90%. Idose Aldose reductase L-iditol...

March 2024. "L'Ex sindaco di Catania Stancanelli dice addio a FdI e si candida alle Europee con la Lega di Salvini". 2 April 2024. "L'Eurodeputata Veronica...