DOKUMEN123.COM

RN5S1@
Identifikatori
Aliasi	RN5S1@
Vanjski ID-jevi	GeneCards: RN5S1@
Ortolozi
	6025
	n/a
	n/a
	n/a
	n; a
	n/a
	n/a
	n/a
	n/a
	n/a
	Wikipodaci
Pogledaj/uredi – čovjek

Klaster 1 5S RNK, znan i kao RN5S1@, je ljudski gen sa hromosoma 1. Kodira podjedinicu 5S ribosomske RNK.^[2]

U relativno davnom radu, iz 1980., saopštenoje da nukleotidna sekvenca podjedinice 5S ribosomske RNK rRNK iz ćelijske plijesni Dictyostelium discoideum ima slijedeči raspored aminokiselina: GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAAUGACAAGGUGGA. Predložen je model za sekundarnu strukturu ove 5S rRNK. Sekvenca je sličnija onima kod životinja (62% sličnosti u prosjeku) nego kod kvasaca (56%).^[3]

A = Adenin
C = Citozin
G = Guanin
U = Uracil

Također pogledajte

Ribosomska RNK

Reference

^ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
^ "Entrez Gene: RN5S1@ RNA, 5S cluster 1".
^ H Hori, S Osawa, and M Iwabuchi (1980): The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum. Nucleic Acids Res., 8(23): 5535–5539; doi: 10.1093/nar/8.23.5535; pmcid: pmc324323; pmid: 7465421.

Dopunska literatura

Cook PJ, Hamerton JL (1980). "Report of the committee on the genetic constitution of chromosome 1". Cytogenet. Cell Genet. 25 (1–4): 9–20. doi:10.1159/000131394. PMID 396131.
Kost MV, Alimov AA, Sarafanov AG, et al. (1994). "5S rRNA gene hybridizes to human chromosome 1 at two sites (1q42.11→q42.13 and 1q43)". Cytogenet. Cell Genet. 68 (1–2): 82–84. doi:10.1159/000133896. PMID 7956368.
Hori H, Osawa S, Iwabuchi M (1981). "The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum". Nucleic Acids Res. 8 (23): 5535–5539. doi:10.1093/nar/8.23.5535. PMC 324323. PMID 7465421.
Forget BG, Weissman SM (1968). "Nucleotide sequence of KB cell 5S RNA". Science. 158 (3809): 1695–1699. doi:10.1126/science.158.3809.1695. PMID 6059650. S2CID 860091.
Forget BG, Weissman SM (1969). "The nucleotide sequence of ribosomal 5 S ribonucleic acid from KB cells". J. Biol. Chem. 244 (12): 3148–65. doi:10.1016/S0021-9258(18)93108-X. PMID 5792654.
Steffensen DM, Prensky W, Dufy P (1974). "Proceedings: Localization of the 5S ribosomal RNA genes in the human genome". Cytogenet. Cell Genet. 13 (1): 153–154. doi:10.1159/000130260. PMID 4827485.
Steffensen DM, Duffey P, Prensky W (1975). "Localisation of 5S ribosomal RNA genes on human chromosome 1". Nature. 252 (5485): 741–743. doi:10.1038/252741a0. PMID 4437633. S2CID 4168307.
Sørensen PD, Lomholt B, Frederiksen S, Tommerup N (1991). "Fine mapping of human 5S rRNA genes to chromosome 1q42.11----q42.13". Cytogenet. Cell Genet. 57 (1): 26–29. doi:10.1159/000133107. PMID 1855389.

[1] "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.

[entrez-2] "Entrez Gene: RN5S1@ RNA, 5S cluster 1".

[3] H Hori, S Osawa, and M Iwabuchi (1980): The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum. Nucleic Acids Res., 8(23): 5535–5539; doi: 10.1093/nar/8.23.5535; pmcid: pmc324323; pmid: 7465421.

[1]

[2]

[3]

RN5S1@

Također pogledajte

Reference

Dopunska literatura

Content Disclaimer