Search Results: SARS1

Sorry, the article you're looking for isn't specifically available. Here are related topics:

Pagoh
Minggu, 2026-03-29 17:56:36

of the secondary schools in Pagoh is SMK Sultan Alauddin Riayat Shah I (SARS1), named after the sultan of Malacca who died in Pagoh. Pagoh Educational...

Click to read more »
SARS (gene)
Jumat, 2025-07-18 01:16:01

SARS1 Available structures PDB Ortholog search: PDBe RCSB List of PDB id codes 3VBB, 4L87, 4RQE, 4RQF Identifiers Aliases SARS1, SERRS, SERS, seryl-tRNA...

Click to read more »
List of human protein-coding genes 7
Rabu, 2026-01-07 00:10:41

Q9UL12 14293 SARM1 HGNC:17074; Q6SZW1 14294 SARNP HGNC:24432; P82979 14295 SARS1 HGNC:10537; P49591 14296 SARS2 HGNC:17697; Q9NP81 14297 SART1 HGNC:10538;...

Click to read more »
TMEM61
Kamis, 2025-10-30 23:21:30

Proteins and Uncovers Widespread Protein Aggregation in Affected Brains SARS1 Host organism: Saccharomyces cerevisiae (Baker's yeast), Neurodegeneration...

Click to read more »
Human identical sequence
Minggu, 2025-09-28 02:59:51

3' UTR Chr18: 73670168-73670142 FBXO15, TIMM21 [uk], CYB5A same as HIS-SARS1-2 HIS-SARS2-5 24 UUGUUGCUGCUAUUUUCUAUUUAA 8610–8633 in ORF1a ChrX: 99693480-99693457...

Click to read more »